Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.065905 |
Chromosome: | chromosome 16 |
Location: | 593551 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g692200 | MMP6 | (1 of 1) IPR003609//IPR008752 - PAN/Apple domain // Peptidase M11, gametolysin; Metalloproteinase of VMP family | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCACGGCGACAAGGTCTGCGCTTCATCAGCACAGTTCTGTGTATGTAAG |
Internal bar code: | TCTAGGTTTCCGTTGGGATTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4820 |
LEAP-Seq percent confirming: | 97.5 |
LEAP-Seq n confirming: | 78 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 80 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACATCACGGCTGCTATCGAG |
Suggested primer 2: | GTTGTGCGCAAACCAGCTAA |