| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.065944 |
| Chromosome: | chromosome 12 |
| Location: | 2852559 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g503150 | (1 of 2) K17680 - twinkle protein [EC:3.6.4.12] (PEO1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTTGAGCGCCTCTTCCCAGCGACACCACACCGCGTACGCTCTTGGGTC |
| Internal bar code: | ATGACAGGTGGTAATCAGGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 908 |
| LEAP-Seq percent confirming: | 27.6596 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAAAGTCGGCTTGCGAGTA |
| Suggested primer 2: | ACGGCAGTTCTACACGTCAG |