| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.065973 |
| Chromosome: | chromosome 14 |
| Location: | 397984 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g610501 | RAA14,SDR34 | (1 of 2) IPR002347//IPR003560 - Glucose/ribitol dehydrogenase // 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase; Short-chain dehydrogenase/reductase found in psaA trans-splicing complex | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACATGTACTCTTCACCCCCTACACCCCTACACCTCCCGCCCACCTGCGA |
| Internal bar code: | TCGGTCGCACGTTGTTAGGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 346 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAATTCAAGGCCCGCGTATG |
| Suggested primer 2: | GCAAGCCTGGCAATTGAACA |