Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.065978 |
Chromosome: | chromosome 16 |
Location: | 2848612 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g801921 | (1 of 1) K12946 - signal peptidase complex subunit 1 (SPCS1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGTCTTGTGATATGTAATGGCAGCTATCTATCGAACGAGCAAGCTTCT |
Internal bar code: | GCGTACCTCGAACAACGCCGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3268 |
LEAP-Seq percent confirming: | 98.5075 |
LEAP-Seq n confirming: | 66 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACACAGCCCTCACGAATCT |
Suggested primer 2: | CCCCTAGAGGTGGACGAGAA |