| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.065991 |
| Chromosome: | chromosome 3 |
| Location: | 5763804 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g187450 | RPI1 | Ribose-5-phosphate isomerase, chloroplastic; (1 of 1) PTHR11934//PTHR11934:SF7 - RIBOSE-5-PHOSPHATE ISOMERASE // RIBOSE-5-PHOSPHATE ISOMERASE 1-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGGTCTGTGGGGGCGGGCGGGCTCCTGGTGGTGCATCTGCGCCTGTGC |
| Internal bar code: | TGACATTGTTAATGAGAATTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 855 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCGACACACATAACCGAA |
| Suggested primer 2: | TACGAGCAGGCTCTGTCTCT |