Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.066022 |
Chromosome: | chromosome 2 |
Location: | 7783227 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g146600 | AP4M4 | Mu4-Adaptin; (1 of 1) K12402 - AP-4 complex subunit mu-1 (AP4M1) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTAACCTGTTTGCCGCATGAAACTACATCGCCAGCTTCCAAATTGACA |
Internal bar code: | GAGCAATTTTTCCGTAAATTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5106 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 122 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 122 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTCGCCAGGAGAGCTTATC |
Suggested primer 2: | CGAACACACGAAACACACCC |