| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.066034 |
| Chromosome: | chromosome 13 |
| Location: | 477670 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g565000 | (1 of 139) IPR011011 - Zinc finger, FYVE/PHD-type | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGGAGGAGGAGGAGCGGCGGGCGCGGCGGGAGGTGCTGAGCCGGCTAC |
| Internal bar code: | TCACTTAGTGAGACCCTATGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 416 |
| LEAP-Seq percent confirming: | 82.6087 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAACTCCCTCTCCACCACC |
| Suggested primer 2: | CTTGCTTGCTTGGTCACCAC |