| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.066038 |
| Chromosome: | chromosome 13 |
| Location: | 4170794 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g591350 | MFT27 | Major facilitator superfamily transporter; (1 of 22) IPR011701//IPR020846 - Major facilitator superfamily // Major facilitator superfamily domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACCCACCGCCAACATTACTTTGTTGTTATGTCATATCACATTCGTTT |
| Internal bar code: | GATACTATACCCCATGTAAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1254 |
| LEAP-Seq percent confirming: | 93.5897 |
| LEAP-Seq n confirming: | 73 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGTGATCCAGGTGCACAT |
| Suggested primer 2: | TTGATTTGCTGTGTGGCTGC |