Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.066047 |
Chromosome: | chromosome 17 |
Location: | 775003 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g701300 | (1 of 1) K17491 - protein phosphatase 4 regulatory subunit 3 (SMEK, PPP4R3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCAGGGGAGTCGGCACTTGCCGAGGGCATATGCACACGCTCTTCCAGT |
Internal bar code: | GGAGGAACAATGTGGTCGTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1173 |
LEAP-Seq percent confirming: | 92.9412 |
LEAP-Seq n confirming: | 79 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 85 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAACGGTCAACACGTCAGGG |
Suggested primer 2: | CATCATCACCATGCAGCAGC |