| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.066061 |
| Chromosome: | chromosome 2 |
| Location: | 1177343 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g081300 | (1 of 13) IPR000086//IPR015797 - NUDIX hydrolase domain // NUDIX hydrolase domain-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTTGACGTGTGGGGCCTCACCGCCACGATCTGCATTGCGGCGGCACGC |
| Internal bar code: | GCCGCATCAGTCTACGGTAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2052 |
| LEAP-Seq percent confirming: | 97.619 |
| LEAP-Seq n confirming: | 41 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTCAGCCCGTCTAGCACT |
| Suggested primer 2: | AGTGTTCCTGGGCACATACG |