| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.066065 |
| Chromosome: | chromosome 3 |
| Location: | 5378564 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g183500 | (1 of 1) K14851 - ribosomal RNA-processing protein 17 (RRP17, NOL12) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGATCGCGGGGTCGGGATGGGGGCGAAAAAACAACTTGTTAAACAACTCA |
| Internal bar code: | TTCCCTTTTCCCAACCCCGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3275 |
| LEAP-Seq percent confirming: | 46.7742 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 62 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCCAGAGGTCTGTCTCGG |
| Suggested primer 2: | AAGAAGAACGCCGTCCATGT |