| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.066085 |
| Chromosome: | chromosome 14 |
| Location: | 1246301 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g616000 | (1 of 35) IPR001763 - Rhodanese-like domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAGTCGTGCGCTGGTCGCATGAAAGGCGCGGCTGGCCGGCTGCGTAAC |
| Internal bar code: | TGAACGAGCGGACTTAAGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1691 |
| LEAP-Seq percent confirming: | 95.7447 |
| LEAP-Seq n confirming: | 45 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAATTTAGCGGGCCGTTCAC |
| Suggested primer 2: | TGCTAGCCCTGCGTTTTGTA |