Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.066137 |
Chromosome: | chromosome 6 |
Location: | 2347735 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g267750 | (1 of 1) PF00050//PF00089 - Kazal-type serine protease inhibitor domain (Kazal_1) // Trypsin (Trypsin) | 3'UTR | |
Cre06.g267800 | MML1,MITC8,MCP8 | (1 of 1) K15119 - solute carrier family 25, member 39/40 (SLC25A39_40); MTM-Like Mn transporter 1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGATGTAACGAATGCGTAGTTGTCCGGCGGCCTGTATTACAGACTGGGC |
Internal bar code: | TTATAGGGCTGGTCGCTCAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4134 |
LEAP-Seq percent confirming: | 97.8723 |
LEAP-Seq n confirming: | 46 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCGATTTTCTTGTCGGACG |
Suggested primer 2: | AGCCAGCTATGAGGTCCTCA |