| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.066142 |
| Chromosome: | chromosome 9 |
| Location: | 1529724 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399350 | FAP199 | (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGCATGTGTCACCGCCCAATGCGGCGGCCACGAAATGAGGTGATTATT |
| Internal bar code: | GGAACTGTATGAGTTTTGAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3197 |
| LEAP-Seq percent confirming: | 98.8764 |
| LEAP-Seq n confirming: | 88 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 89 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTCCAGTGCACCGTATAT |
| Suggested primer 2: | AAACGAGGGCATGGAGGATG |