Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.066172 |
Chromosome: | mitogenome |
Location: | 7255 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreMt.g802341 | 801491,nad2,ChrepMp05 | (1 of 1) K03879 - NADH-ubiquinone oxidoreductase chain 2 (ND2); NADH dehydrogenase subunit 2 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTACCGTACAAATCAACACTCCACATGTGCATTGGGGCTACACCCAACT |
Internal bar code: | TAAGAACAGGGTCAAAGAGTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 981 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAACGGCCATGTGTCTTTGG |
Suggested primer 2: | GCAGCAGCCAACAAACTGAA |