Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.066178 |
Chromosome: | chromosome 3 |
Location: | 5189930 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g181450 | TCTN1,POB7 | (1 of 1) K19382 - tectonic-1/3 (TCTN1_3); Proteome of basal body 7 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAAAATAATTCCTGTAAGCCGTGCTTGTGGTCAATTGCACTGCCGGAC |
Internal bar code: | GTACTATCTTAATATACGAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 463 |
LEAP-Seq percent confirming: | 10.6383 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCAGGCGAGATTACGATGC |
Suggested primer 2: | CTGAACAAACAAGCGCGTCA |