Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.066186 |
Chromosome: | chromosome 2 |
Location: | 1876171 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g087450 | (1 of 4) PTHR16255:SF4 - SPORULATION PROTEIN RMD8 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGTCTACCCTACACCGTCTCTGTTGCATATAGGGCATGTAGGTTTTCT |
Internal bar code: | ATGTACGTTCTTCGGTGAGGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 114 |
LEAP-Seq percent confirming: | 16.6667 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTTCCAAGCAAACACCAGC |
Suggested primer 2: | TGACCCGTCACAACTTACCG |