| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.066192 |
| Chromosome: | chromosome 13 |
| Location: | 2707734 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g581750 | (1 of 3) K10752 - histone-binding protein RBBP4 (RBBP4, HAT2, CAF1, MIS16) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCACACCACACTGCACTTGTCCCGGTTCAGCACCATAACACCACCACC |
| Internal bar code: | GGTTTGGGTGTTAAAGCTGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 343 |
| LEAP-Seq percent confirming: | 60.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTACGGTAAACACACGCT |
| Suggested primer 2: | TAGCGTCATGTGGAACGGAC |