Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.066217 |
Chromosome: | chromosome 10 |
Location: | 5608352 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g458450 | GPX5,GPXH | Glutathione peroxidase 5; (1 of 4) 1.11.1.9 - Glutathione peroxidase | CDS |
Cre10.g458500 | ASK1,AHD2 | Aspartate kinase; (1 of 1) K00928 - aspartate kinase (lysC) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACTCCTCAATAGCCAGCGCGTCAACATCTGCAGGGAATTGCCTCAACT |
Internal bar code: | AGTCCTCAGTCGAGGTGGGTTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 461 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACAGCAGGTGATGGGTTGA |
Suggested primer 2: | CGAGTTGAAACGCCAGCAAA |