Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.066234 |
Chromosome: | chromosome 12 |
Location: | 4761451 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g523100 | (1 of 4) PF05653 - Magnesium transporter NIPA (Mg_trans_NIPA) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGAGGCCTTGATGCTCTGGTAATCCCGTCATCGCTTCATTGTCCGGAC |
Internal bar code: | ACTTTGATCAGATGCCGTCAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2029 |
LEAP-Seq percent confirming: | 80.0 |
LEAP-Seq n confirming: | 24 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCAGGATCGTGCGCTGATA |
Suggested primer 2: | GCTGCTGCTGGAATCGAATG |