| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.066290 |
| Chromosome: | chromosome 12 |
| Location: | 1878288 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g512100 | PIF1 | (1 of 1) IPR003593//IPR003840//IPR010285//IPR013785//IPR027417 - AAA+ ATPase domain // DNA helicase // DNA helicase Pif1-like // Aldolase-type TIM barrel // P-loop containing nucleoside triphosphate hydrolase; {"PIF1-related DNA helicase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTGCTGCTGCAACGGCTGCCGCTGGCGGCCTGGCGGCCGTTGCTGCTG |
| Internal bar code: | CGAGTCTTGTTGATAGTCTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4787 |
| LEAP-Seq percent confirming: | 2.85714 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGGTGTAATGTAGCAGGT |
| Suggested primer 2: | CTGCAGCGCATCACTTCATC |