| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.066301 |
| Chromosome: | mitogenome |
| Location: | 1720 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreMt.g802338 | nad4,801494,ChrepMp02 | NADH dehydrogenase subunit 4; (1 of 1) K03881 - NADH-ubiquinone oxidoreductase chain 4 (ND4) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGTTTAATACCTAGCCATACAGCACCAATTAGCAATGGTAGGACAGTA |
| Internal bar code: | AAAGTATTATCTCAAAGACGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 111 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTCCAACTGCTGGTAGTG |
| Suggested primer 2: | GAGCCAAGAACAAAGCACCG |