| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.066343 |
| Chromosome: | plastome |
| Location: | 31612 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802280 | psaA_exon1,ChreCp019,2717000 | (1 of 15) 1.97.1.12 - Photosystem I; photosystem I P700 apoprotein A1 transpliced exon 1 of 3 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACACCATTAGCAACGCTTTTAATTATTATGTGTTCATAAAAAATGCAT |
| Internal bar code: | TAAAGCTGCTCGGATAAAAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 78 |
| LEAP-Seq percent confirming: | 20.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTGAAGCTCGTCTACGTG |
| Suggested primer 2: | CCGCAACATTTTCCTTGGCA |