Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.066345 |
Chromosome: | chromosome 2 |
Location: | 2272044 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g090150 | CAF2,PANC,PAN3,PANC1 | (1 of 1) 6.3.2.1 - Pantoate--beta-alanine ligase (AMP-forming) / Pantothenate synthetase; Pantothenate synthetase | 3'UTR |
Cre02.g800194 | (1 of 2) PF14753 - Domain of unknown function (DUF4475) (DUF4475) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCGGGCGGCTGGCTACAATGGTCAGTGGCAGTGGCTAGCACAGGCTCT |
Internal bar code: | GCTGCAAAGACTGAAACCGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 662 |
LEAP-Seq percent confirming: | 97.5 |
LEAP-Seq n confirming: | 39 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAGGAGAGGTTGGAGCTTG |
Suggested primer 2: | GAAGGGGGTTAAGGGTTGGG |