| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.066556 |
| Chromosome: | chromosome 6 |
| Location: | 4261318 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278253 | (1 of 44) IPR000048 - IQ motif, EF-hand binding site | 5'UTR | |
| Cre06.g278254 | (1 of 1) K08832 - serine/threonine-protein kinase SRPK3 [EC:2.7.11.1] (SRPK3, STK23) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTGAAAAATTTCAGGTCAACGGTAGTTCGCTGCGTGCGTAAATGCTAA |
| Internal bar code: | ATCTACAATTGATTTGAAGCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1988 |
| LEAP-Seq percent confirming: | 77.7778 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATCTCGTTGTTGGGGTCG |
| Suggested primer 2: | CAATGTTCTATGCGGTGGCG |