| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.066607 |
| Chromosome: | chromosome 12 |
| Location: | 9803354 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g548152 | (1 of 1) K15084 - solute carrier family 25 (mitochondrial carrier protein), member 16 (SLC25A16, GDA, LEU5) | 3'UTR | |
| Cre12.g548577 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACATCACGCAACTGTACTACCGACACAGATACATTCCAGTGCCACGCA |
| Internal bar code: | ATTAAAATACAATGCTAGGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 278 |
| LEAP-Seq percent confirming: | 3.0303 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 32 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCCCATGTCACCCCATAT |
| Suggested primer 2: | TGTCAGCTGTTGCGTTTTCG |