Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.066611 |
Chromosome: | chromosome 8 |
Location: | 1876851 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g367400 | LHCSR3,LHCSR3B,LI818r | Stress-related chlorophyll a/b binding protein 3; (1 of 3) K08907 - light-harvesting complex I chlorophyll a/b binding protein 1 (LHCA1) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAAGTGGCGTGCAAGTGAACTGAAGCAAGTGCGTAGCAGGCGAGTGCG |
Internal bar code: | GGGATAGGGACTGTCAATCATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 918 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGCGGCCTGAAAAGAAGAT |
Suggested primer 2: | AAGTGCGGACGGTACACAAT |