| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.066623 |
| Chromosome: | chromosome 16 |
| Location: | 913218 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g648300 | PHT6,PHT4-6,PHT4F | Sodium-dependent phosphate transporter, major facilitator superfamily; (1 of 3) PTHR11662:SF243 - ANION TRANSPORTER 6, CHLOROPLASTIC-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCCTGTGTGTGGCACAGCGACACCACACCCACACATCACTGCTGCCG |
| Internal bar code: | CTTCCATCTATAGGTTAAAGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 955 |
| LEAP-Seq percent confirming: | 95.1219 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAACCACCGACAAGCGTAT |
| Suggested primer 2: | ATCGTTGCGTGTTGGAGTCT |