| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.066633 |
| Chromosome: | chromosome 13 |
| Location: | 1075599 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g568850 | ISU1,NFU1 | Iron-sulfur cluster assembly scaffold protein; (1 of 1) PTHR10093 - IRON-SULFUR CLUSTER ASSEMBLY ENZYME NIFU HOMOLOG | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAAAGAAACGGGTTATGCGCGGCGTGTAACGCCGCATGGTCAACCGTT |
| Internal bar code: | GGAGATCAAGAATATACGATCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1515 |
| LEAP-Seq percent confirming: | 92.8571 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGTCATGGTAGTGGCAGT |
| Suggested primer 2: | TGGGTTGGGAGAACGCTTAC |