| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.066649 |
| Chromosome: | chromosome 3 |
| Location: | 360362 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g144667 | CLPS4,CLPT4 | (1 of 2) IPR023150 - Double Clp-N motif; Additional subunit of chloroplast ClpP complex | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCGTGTCGCAGTGCATAGTCACGCCGGTCTGGGCGTGCGAGCAATACT |
| Internal bar code: | GGTTACCACTGAACAGTACAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2786 |
| LEAP-Seq percent confirming: | 96.5517 |
| LEAP-Seq n confirming: | 196 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 203 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTCATGCCGCTACCGTTG |
| Suggested primer 2: | ACGGCAGCAAAGATCCTGAA |