| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.066669 |
| Chromosome: | chromosome 16 |
| Location: | 5045381 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g685900 | PRM3,PRMT3 | Protein arginine N-methyltransferase; (1 of 1) K11436 - protein arginine N-methyltransferase 3 [EC:2.1.1.-] (PRMT3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCTCCCTGAGCCCTGACCGCCCGTGTATACCAGTCCAGTAGTCACTAG |
| Internal bar code: | GTTTGTGGGGGGTTTAAAACTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1373 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAATGGAATGGCCGAGCT |
| Suggested primer 2: | AAGAAAGAAGAGGCAGGCCC |