| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.066730 |
| Chromosome: | chromosome 14 |
| Location: | 2843067 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g626900 | PMM1,PMM | Phophomannomutase; (1 of 1) K17497 - phosphomannomutase (PMM) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCACACCGCCGCCCCCCCCCCGCCCGTCCACTACCACTCCATCCTCCA |
| Internal bar code: | GGGAACCTATTCATCTATCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 140 |
| LEAP-Seq percent confirming: | 62.5 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATTGGTGGGTTTAGGGGG |
| Suggested primer 2: | CACCTCATAGCGACTCGGTC |