| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.066747 |
| Chromosome: | chromosome 10 |
| Location: | 2109947 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g433050 | ARCS,DRP5B,ARC5,DRP8 | Putative dynamin GTPase involved in plastid division; (1 of 1) PTHR11566:SF78 - DYNAMIN-LIKE PROTEIN ARC5 | 3'UTR |
| Cre10.g433100 | OBGE1,OBGE | Factor possibly involved in assembly of the ribosomal 50S assembly; (1 of 1) K03979 - GTP-binding protein (obg) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTCATGAATATGCGTACGGGGTGCACTGTGTTGCAGCACCTTGACCCA |
| Internal bar code: | GATTGGGATTAAAATGCTCTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5553 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 81 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 81 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGATGCCCAAAATGCGGTG |
| Suggested primer 2: | GCATAGCATGGCACGATGTG |