| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.066769 |
| Chromosome: | chromosome 2 |
| Location: | 5972032 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g118250 | SWB1 | SWIB domain-containing protein; (1 of 1) K15223 - upstream activation factor subunit UAF30 (UAF30, SPP27) | 3'UTR |
| Cre02.g118300 | RHE,HEL12 | (1 of 1) PTHR24031:SF330 - DEAD-BOX ATP-DEPENDENT RNA HELICASE 7; DEAD box ATP-dependent RNA helicase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGGGCCTTGCAATATACTTCTTATTACAACAGTGACCTTGCAGACCAC |
| Internal bar code: | TATAGTCTAGGGTGCATCGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1457 |
| LEAP-Seq percent confirming: | 90.625 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCGACTCGATGTTTTGGC |
| Suggested primer 2: | AGACGGTAGGGGGTTACCTC |