| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.066798 |
| Chromosome: | chromosome 6 |
| Location: | 344424 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g251250 | HIK3,HKR3,HIK | (1 of 1) PF00072//PF00512//PF02518 - Response regulator receiver domain (Response_reg) // His Kinase A (phospho-acceptor) domain (HisKA) // Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (HATPase_c); Histidine kinase response regulator of two-component system | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGCACCCACCCTCCCAAATGCACACACGCACGCGAACACGCCAACGCG |
| Internal bar code: | GGGTATTGCCCACTTCCAAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 685 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGTGAGGAGAAGGGGTTC |
| Suggested primer 2: | CGTCAGCAACTTCCTGGACT |