| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.066832 |
| Chromosome: | chromosome 6 |
| Location: | 1944395 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g264650 | HTR14,HTR27 | Histone H3; (1 of 35) K11253 - histone H3 (H3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATCGTCACACGCTTGGCGTGGATGGCGCACAGGTTGGTGTCCTCGAAC |
| Internal bar code: | TCCAACTGTTGCCGGGCCGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1753 |
| LEAP-Seq percent confirming: | 36.5854 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGATAGCGGGCTTGGTAAT |
| Suggested primer 2: | CTAAGCGCGCCGAACTTAAC |