Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.066841 |
Chromosome: | contig 35 |
Location: | 14682 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre35.g802212 | (1 of 2) PTHR18945:SF559 - PROTEIN LGC-12 | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCGGGCCATACAGCGCTTGCCGGCAATGCATAACTGCTCTCCAGGAGC |
Internal bar code: | CATGTAATACTTCGCCGTGACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3552 |
LEAP-Seq percent confirming: | 4.7619 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCACTGCAGCACCACATAT |
Suggested primer 2: | AACGGTACTGTGCGACACAT |