| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.066841 |
| Chromosome: | contig 35 |
| Location: | 14682 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre35.g802212 | (1 of 2) PTHR18945:SF559 - PROTEIN LGC-12 | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCGGGCCATACAGCGCTTGCCGGCAATGCATAACTGCTCTCCAGGAGC |
| Internal bar code: | CATGTAATACTTCGCCGTGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3552 |
| LEAP-Seq percent confirming: | 4.7619 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCACTGCAGCACCACATAT |
| Suggested primer 2: | AACGGTACTGTGCGACACAT |