| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.066849 |
| Chromosome: | chromosome 17 |
| Location: | 763044 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g701200 | RPL14 | Cytosolic 80S ribosomal protein L14; (1 of 1) K02875 - large subunit ribosomal protein L14e (RP-L14e, RPL14) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTTAGAGTGGCAACGATGGTCCGTGGTGTGACGGGCTGGAGCATTCGG |
| Internal bar code: | GGTGTTCACGCACTGGGCCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3667 |
| LEAP-Seq percent confirming: | 98.4127 |
| LEAP-Seq n confirming: | 62 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTGCGAGTGAGAAGTTGG |
| Suggested primer 2: | CGCTTCTTGTAGCATCACGC |