Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.066878 |
Chromosome: | chromosome 17 |
Location: | 2847887 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g718600 | (1 of 4) 3.1.1.23 - Acylglycerol lipase / Monoacylglycerol lipase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTCTTCCTGCCCCAACGCAGCGGCTATGACCTGTACACCACCACCTTC |
Internal bar code: | ACGTGGATGAGCACTTTGTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 518 |
LEAP-Seq percent confirming: | 2.77778 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 35 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCGGGAAGGAAGGATGTTG |
Suggested primer 2: | GACAGCGGGTACAAAGGACA |