| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.066899 |
| Chromosome: | chromosome 16 |
| Location: | 96785 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g695550 | 3'UTR | ||
| Cre16.g695600 | DNJ10 | DnaJ-like protein and Myb-like transcription factor; (1 of 1) PTHR24078:SF307 - MOLECULAR CHAPERONE HSP40/DNAJ-LIKE PROTEIN | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTGATGGAGCGGCTGGGTCGGCACATACAATCAATCCAATGGCGGTCT |
| Internal bar code: | ACTGTCAGAGGGTTGGCAGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 991 |
| LEAP-Seq percent confirming: | 44.186 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCTGCCGTACGAGTACTAC |
| Suggested primer 2: | ACACCCAATTCCCCGATCAC |