| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.066902 |
| Chromosome: | chromosome 9 |
| Location: | 1391437 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g400150 | (1 of 2) PF13415//PF13418 - Galactose oxidase, central domain (Kelch_3) // Galactose oxidase, central domain (Kelch_4) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTTTTCACGCTGCAAAGCAGTCAACTGCATTCAACACCCCCGTCGCAG |
| Internal bar code: | ACGAAGATCGAGTGATAGTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2452 |
| LEAP-Seq percent confirming: | 78.125 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGAGGGATTCGAGGCATG |
| Suggested primer 2: | CTCGCAGTTTGATAACGCCG |