| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.066911 |
| Chromosome: | chromosome 13 |
| Location: | 2694554 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g581550 | THG1 | Histidine tRNA 5'-guanylyltransferase; (1 of 1) 2.7.7.79 - tRNA(His) guanylyltransferase / Histidine tRNA guanylyltransferase | 3'UTR |
| Cre13.g581600 | ASA4 | Mitochondrial F1F0 ATP synthase associated protein 4 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACATGCTCTGCGAGTCTCCCCGGCCCTTGCCGCTGCTTTCGATGAAGA |
| Internal bar code: | ATGGCGGTTTGTTAATCATTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2053 |
| LEAP-Seq percent confirming: | 97.6744 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCGGGATAAACTACGCGCA |
| Suggested primer 2: | TACAGGGAGGTCAGGTAGGC |