Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.066955 |
Chromosome: | chromosome 10 |
Location: | 3866189 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g446200 | (1 of 1) PF11566 - PI31 proteasome regulator N-terminal (PI31_Prot_N) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGTGCGCACGTGGAGTCCCGGCACTCATGGAGGCGAATGGCTGACAG |
Internal bar code: | TGGGGAGTCGGGTAAGATGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4842 |
LEAP-Seq percent confirming: | 91.0891 |
LEAP-Seq n confirming: | 92 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 101 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATACATGGGCGCATAGTCGG |
Suggested primer 2: | TGGTTTCAGGGCACAACTGT |