| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.066987 |
| Chromosome: | chromosome 11 |
| Location: | 657366 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467615 | (1 of 2) IPR000742//IPR001881//IPR009030 - EGF-like domain // EGF-like calcium-binding domain // Insulin-like growth factor binding protein, N-terminal | 3'UTR | |
| Cre11.g467616 | Dyf-13,IFT56,Ttc26 | (1 of 3) PF12895 - Anaphase-promoting complex, cyclosome, subunit 3 (ANAPC3); Intraflagellar Transport Protein 56 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACATGAGCGTTCCTGTAACTGCCCCGTGCCGCCTGTAACTCAGAGTCTT |
| Internal bar code: | CTCATGCTTCACTTCGCGTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1195 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGTGGGCCAAGAACAACG |
| Suggested primer 2: | TCTGGTCGCTGCAAACTGAT |