| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.067001 |
| Chromosome: | plastome |
| Location: | 171179 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802327 | 2716959,atpI,ChreCp062 | ATPase IV subunit; (1 of 1) K02108 - F-type H+-transporting ATPase subunit a (ATPF0A, atpB) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTAATAAGGCACCTGACCAGTTAGAAACGAAAATAAATAAGAAAATAG |
| Internal bar code: | GGATTGTCCGCAATTCAGCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 154 |
| LEAP-Seq percent confirming: | 4.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTGGCAAACTGTGAGGCTG |
| Suggested primer 2: | GCACCCGCTAAAGTTGCAAA |