| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.067008 |
| Chromosome: | chromosome 6 |
| Location: | 1162877 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g258100 | (1 of 2) PTHR12436//PTHR12436:SF4 - 80 KDA MCM3-ASSOCIATED PROTEIN // LEUKOCYTE RECEPTOR CLUSTER MEMBER 8 | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGGCGCGGCGCCGAATCTGAGAGCCCCGGCGAAATGGCTCCAAGCCCT |
| Internal bar code: | TAAGCTAGCATGTACCATGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1273 |
| LEAP-Seq percent confirming: | 25.0 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAACCGCAAGCAGACGAGTT |
| Suggested primer 2: | GGTCGTAGCCGTAATACCCG |