| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.067061 |
| Chromosome: | chromosome 16 |
| Location: | 4051831 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g690350 | SNR6 | SNARE-associated Golgi protein; (1 of 1) PTHR12677:SF24 - TRANSMEMBRANE PROTEIN 64 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCCCAAATGCTGCTGGGAGGTGCGCAGCCCGGCAATACGGACGGACG |
| Internal bar code: | CGGGAAAGTGGTTAGGCATATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1988 |
| LEAP-Seq percent confirming: | 96.875 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGGTTGTTGGCCGTGTAC |
| Suggested primer 2: | ACCTACTCCCTACCACGACC |