| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.067073 |
| Chromosome: | chromosome 1 |
| Location: | 945522 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g005400 | SDR1 | Short-chain dehydrogenase/reductase; (1 of 23) PF13561 - Enoyl-(Acyl carrier protein) reductase (adh_short_C2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCATGACTGGGGTGGGGTACTTGTTGACGACCATGGGTCAATGCTACAT |
| Internal bar code: | CCCCATACAAACAAAATGGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 190 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTGATGTACGAGGAGTCC |
| Suggested primer 2: | TGTGTGCGTGTGTGATACGA |