| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.067076 |
| Chromosome: | chromosome 3 |
| Location: | 818657 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g146347 | (1 of 3) PTHR11220//PTHR11220:SF1 - HEME-BINDING PROTEIN-RELATED // HEME-BINDING PROTEIN 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCTCACTCGTCAGTAGCGCCCGCCATCATCGCACACTCGTGCCAGCTG |
| Internal bar code: | TGGCGTATCTTGACGCTAAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3024 |
| LEAP-Seq percent confirming: | 98.3471 |
| LEAP-Seq n confirming: | 119 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 121 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTACACAGGTCGACGTGG |
| Suggested primer 2: | GCCCGCTAATGATTGCTGTG |