Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.067087 |
Chromosome: | chromosome 1 |
Location: | 4880496 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g034000 | IPB1 | Importin beta; (1 of 1) K14293 - importin subunit beta-1 (KPNB1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCTGGACGCGCGGCTCCGTCGCCCAGCGCTGCTCGGCTTCGATAAAAA |
Internal bar code: | GGGGGGCACCAGTAGAATGCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 860 |
LEAP-Seq percent confirming: | 28.5714 |
LEAP-Seq n confirming: | 6 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGAATCGTCCTCGCTACAA |
Suggested primer 2: | CGACGTACATTCGACGCAAC |